GENTAUR Belgium BVBA BE0473327336 Voortstraat 49, 1910 Kampenhout BELGIUM Tel 0032 16 58 90 45
GENTAUR U.S.A Genprice Inc 6017 Snell Ave, Ste 357, SanJose, CA 95123
Tel (408) 780-0908, Fax (408) 780-0908,

Index / BBridge / E.coli LexA repressor / Product Detail : 01-006 E.coli LexA repressor
Related keywords:


#01-006 E.coli LexA repressor

Ask technical file .

  Price : 1298   EUR
1474   USD
1007   GBP
5455   Zloty
173771   JPY
10015   NOK
10731   SEK
1468   CHF

Product name : E.coli LexA repressor

Catalog number : 01-006

Quantity: 100 ug

Availability: Yes

Supplier name : BBridge

ask pdf gentaur products Data sheet: Ask more or other datasheet now !

More Details about

E. coli LexA protein inhibits the transcription of the genes belonging to the SOS regulon that are
related to DNA repair and cell division by recognizing and binding to the SOS-box sequence
(TACTGTATATATATACAGTA). LexA‘s self-protease activity is promoted by RecA protein which,
responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells.
It is cleaved into two fragments and loses its function as a repressor. As the result, the expression of
genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the
cells are enhanced (1).
LexA fused genes are used as baits in the experiments to detect the protein-protein interaction in the
yeast two-hybrid method (2).
The product is over-produced as a recombinant protein, and highly purified by several steps of
chromatography. A single band is observed by SDS-PAGE at 23 kD (Fig 1).

• Studies on the mechanism of E. coli SOS response.
• Used as an antigen for positive control in Western blotting to confirm that the Bait construct is
expressed stably in the nucleus as protein of the expected size in the yeast two-hybrid method
using the LexA gene. See also antibody to LexA protein (#61-001, #61-002)

Purity: Over 90% by SDS-PAGE (CBB staining)
Protein concentration: 0.8 mg/ml* as measured by BCA method
Form: 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM mercaptoethanol
Storage: -20c

1. Waker GC, Cold Spring Harb. Symp. Quant. Biol. 65:1-10 (2000)
2. Sambrook J & Russell DW, Molecular Cloning 3 rd Ed. Chapter 18.17-18.27 (2001) Cold Spring Harber Laboratory Press

Fig. 1: Polyacrylamide gel electrophoresis of LexA protein.

Contact us about this product :

Our team will respond you as soon as possible !

Email :
Skype :
Name :
Phone :
address :
Question, Comment ... :
arrow security gentaurPlease retype this code below:
BBridge \ E.coli_LexA_repressor \ 01_006
Reload Image


GENTAUR Belgium BVBA BE0473327336
Voortstraat 49, 1910 Kampenhout BELGIUM
Tel 0032 16 58 90 45

Fax 0032 16 50 90 45 | Gentaur

Howard Frank Turnberry House
1404-1410 High Road
Whetstone London N20 9BH
Tel 020 3393 8531 Fax 020 8445 9411 | Gentaur



9, rue Lagrange, 75005 Paris
Tel 01 43 25 01 50

Fax 01 43 25 01 60
RCS Paris B 484 237 888

SIRET 48423788800017


Marienbongard 20
52062 Aachen Deutschland
Support Karolina Elandt
Tel: 0035929830070
Fax: (+49) 241 56 00 47 88

Logistic :0241 40 08 90 86
Bankleitzahl 39050000
IBAN lautet DE8839050000107569353
Handelsregister Aachen HR B 16058
Umsatzsteuer-Identifikationsnummer *** DE 815175831
Steuernummer 201/5961/3925 | Gentaur

Genprice Inc, Logistics
547, Yurok Circle
San Jose, CA 95123
CA 95123
Tel (408) 780-0908,
Fax (408) 780-0908,

Genprice Inc, Invoices and accounting
6017 Snell Ave, Ste 357
San Jose, CA 95123

GENTAUR Nederland BV
NL850396268B01 KVK nummer 52327027
Kuiper 1
5521 DG Eersel Nederland
Tel:  0208-080893  Fax: 0497-517897 | Gentaur
IBAN: NL04 RABO 0156 9854 62   SWIFT RABONL2U

tel:0911876558 | Gentaur

ID # 201 358 931 /BULSTAT
София 1000, ул. "Граф Игнатиев" 53 вх. В, ет. 2
Tel 0035924682280 Fax 0035924808322
e-mail: | Gentaur
IBAN: BG11FINV91501014771636

GENTAUR Poland Sp. z o.o.

ul. Grunwaldzka 88/A m.2
81-771 Sopot, Poland
TEL Gdansk 058 710 33 44 FAX  058 710 33 48       | Gentaur

Other countries

Österreich +43720880899

Canada Montreal +15149077481

Ceská republika Praha +420246019719

Danmark +4569918806

Finland Helsset +358942419041

Magyarország Budapest +3619980547

Ireland Dublin+35316526556


Norge Oslo+4721031366

Sverige Stockholm+46852503438

Schweiz Züri+41435006251

US New York+17185132983

SRL IVA IT03841300167
Piazza Giacomo Matteotti, 6
24122 Bergamo Tel 02 36 00 65 93
Fax 02 36 00 65 94 | Gentaur