GENTAUR Belgium BVBA BE0473327336 Voortstraat 49, 1910 Kampenhout BELGIUM Tel 0032 16 58 90 45
GENTAUR U.S.A Genprice Inc 6017 Snell Ave, Ste 357, SanJose, CA 95123
Tel (408) 780-0908, Fax (408) 780-0908, sales@genprice.com

Index / Athen / ACES™ Signal Sequence Kit / Product Detail : 0148-2 ACES™ Signal Sequence Kit
Related keywords:

Sep
27th

#0148-2 ACES™ Signal Sequence Kit

Ask technical file .

  Price : 600   EUR
681   USD
465   GBP
2521   Zloty
80301   JPY
4628   NOK
4959   SEK
678   CHF

Product name : ACES™ Signal Sequence Kit

Catalog number : 0148-2

Quantity: 1

Availability: Yes

Supplier name : Athen

ask pdf gentaur products Data sheet: Ask more or other datasheet now !

More Details about

 

ACES™ Signal Sequence Kit

ACES™ (AthenaES™ Complete Expression System): Signal Sequence Kit

The ACES™ (AthenaES™ Complete Expression System) Signal Sequence Kit provides a set of six expression vectors each with a different signal sequence for protein export to the periplasmic space of E. coli using either the SEC, SRP or TAT protein secretion pathway. Since the use of a post-translational or co-translational export mechanism is protein-specific and cannot be known a priori, this kit allows for the selection of the translocation pathway best suited for a given recombinant protein.

 

 

pAES30                                                                       SRP                                 4,715 bp
AAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCG
 
pAES31                                                                       Sec                                   4,721 bp
AAAAAGACAGCTATCGCGATTGCAGTGGCACTGGCTGGTTTCGCTACCGTAGCGCAGGCG
 
pAES32                                                                       Sec                                   4,721 bp
AAACAAAGCACTATTGCACTGGCACTCTTACCGTTACTGTTTACCCCTGTGACAAAAGCG
 
pAES33                                                                       TAT                                    4,753 bp
TCACTCAGTCGGCGTCAGTTCATTCAGGCATCGGGGATTGCACTTTGTGCAGGCGCTGTTCCACTGAAGGCCAGCGCAGCAGATCTACTAGT
 
pAES34                                                                      TAT                                      4,789 bp
AACAATAACGATCTCTTTCAGGCATCACGTCGGCGTTTTCTGGCACAACTCGGCGGCTTAACCGTCGCCGGTATGCTGGGTCCGTCATTGTTAACGCCGCGACGTGCGACGGCAGCAGATCTACTA
GT
 
pAES35                                                                     SRP                                      4,712 bp
CGCGTACTGCTATTTTTACTTCTTTCCCTTTTCATGTTGCCGGCATTTTCG

 

 

Component Quantity
Plasmids
pAES30 10µg
pAES31 10µg
pAES32 10µg
pAES33 10µg
pAES34 10µg
pAES35 10µg
Strain
JM109 Competent Cells 2 x 200µL
Medium
Turbo Broth™ 1L
Superior Broth™ 1L
Power Broth™ 1L
Hyper Broth™ 1L
Glucose M9Y 1L
Glucose Nutrient Mix 21g
LB Miller Broth 1L
Medium Supplements
Augmedium™ 25mL
Inducer Solution A 1mL
Inducer Solution B 100mL
Secretion Enhancer Solution A 60mL
Secretion Enhancer Solution B

60mL

 

 

 

Contact us about this product :

Our team will respond you as soon as possible !

Email :
Skype :
Name :
Phone :
address :
Question, Comment ... :
arrow security gentaurPlease retype this code below:
Athen \ ACES™_Signal_Sequence_Kit \ 0148_2
Reload Image

 

GENTAUR Belgium BVBA BE0473327336
Voortstraat 49, 1910 Kampenhout BELGIUM
Tel 0032 16 58 90 45

Fax 0032 16 50 90 45
info@gentaur.com | Gentaur





GENTAUR Ltd.
Howard Frank Turnberry House
1404-1410 High Road
Whetstone London N20 9BH
Tel 020 3393 8531 Fax 020 8445 9411
uk@gentaur.com | Gentaur

 

 




GENTAUR France SARL
9, rue Lagrange, 75005 Paris
Tel 01 43 25 01 50

Fax 01 43 25 01 60
RCS Paris B 484 237 888

SIRET 48423788800017

BNP PARIBAS PARIS PL MAUBERT BIC BNPAFRPPPRG

france@gentaur.com | Gentaur

GENTAUR GmbH
Marienbongard 20
52062 Aachen Deutschland
Support Karolina Elandt
Tel: 0035929830070
Fax: (+49) 241 56 00 47 88

Logistic :0241 40 08 90 86
Bankleitzahl 39050000
IBAN lautet DE8839050000107569353
Handelsregister Aachen HR B 16058
Umsatzsteuer-Identifikationsnummer *** DE 815175831
Steuernummer 201/5961/3925
de@gentaur.com | Gentaur

GENTAUR U.S.A
Genprice Inc, Logistics
547, Yurok Circle
San Jose, CA 95123
CA 95123
Tel (408) 780-0908,
Fax (408) 780-0908,
sales@genprice.com

Genprice Inc, Invoices and accounting
6017 Snell Ave, Ste 357
San Jose, CA 95123




GENTAUR Nederland BV
NL850396268B01 KVK nummer 52327027
Kuiper 1
5521 DG Eersel Nederland
Tel:  0208-080893  Fax: 0497-517897
nl@gentaur.com | Gentaur
IBAN: NL04 RABO 0156 9854 62   SWIFT RABONL2U






GENTAUR Spain
tel:0911876558
spain@gentaur.com | Gentaur






ГЕНТАУЪР БЪЛГАРИЯ
ID # 201 358 931 /BULSTAT
София 1000, ул. "Граф Игнатиев" 53 вх. В, ет. 2
Tel 0035924682280 Fax 0035924808322
e-mail: Sofia@gentaur.com | Gentaur
IBAN: BG11FINV91501014771636
BIC: FINVBGSF

GENTAUR Poland Sp. z o.o.


ul. Grunwaldzka 88/A m.2
81-771 Sopot, Poland
TEL Gdansk 058 710 33 44 FAX  058 710 33 48              

poland@gentaur.com | Gentaur

Other countries

Österreich +43720880899

Canada Montreal +15149077481

Ceská republika Praha +420246019719

Danmark +4569918806

Finland Helsset +358942419041

Magyarország Budapest +3619980547

Ireland Dublin+35316526556

Luxembourg+35220880274

Norge Oslo+4721031366

Sverige Stockholm+46852503438

Schweiz Züri+41435006251

US New York+17185132983

GENTAUR Italy
SRL IVA IT03841300167
Piazza Giacomo Matteotti, 6
24122 Bergamo Tel 02 36 00 65 93
Fax 02 36 00 65 94
italia@gentaur.com | Gentaur